| Sequence ID | >SRA1026212 |
| Genome ID | SRR035085.164050 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 221 |
| End posion on genome | 148 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
taaaaataac |
| tRNA gene sequence |
GCAGGCATAGTTCAACGGTAGAATTATAGCCTTCCAAGCTAAGGATAAGAGTTCGAGTCT |
| Downstream region at tRNA end position |
taagctggtg |
| Secondary structure (Cloverleaf model) | >SRA1026212 Gly TCC
c TCCA taagctggtg
G - C
C - G
A - T
G - C
G - C
C - G
A - T T G
T T T C T C A
A A A | | | | | G
C C T T G A A G A G C
G | | | + T T
G G A A T
T A T GGAT
A A
T - A
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |