| Sequence ID | >SRA1026666 |
| Genome ID | SRR035085.253875 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 274 |
| End posion on genome | 199 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
ttccatttaT |
| tRNA gene sequence |
GGACGTATGGCTAAAGTGGTTAAGGCAGTCGACTGATATTCGAAAGAACACCGGTTCAAA |
| Downstream region at tRNA end position |
tatgcaccca |
| Secondary structure (Cloverleaf model) | >SRA1026666 Ile GAT
T ATtt tatgcaccca
G - C
G - C
A - T
C - G
G + T
T - A
A - T T A
T T G G C C A
G A A G | | | | | A
T A T C G A C C G G C
G + | | T T
G A G G C
T T A A AGAAC
G A
T - A
C - G
G - C
A - T
C T
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |