| Sequence ID | >SRA1026831 |
| Genome ID | SRR035085.305753 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 159 |
| End posion on genome | 233 |
| Amino Acid | Arg |
| Anticodon | TCG |
| Upstream region at tRNA start position |
tataatatcc |
| tRNA gene sequence |
GCCCCCGTGGCTCAACTGGATAGAGTGCCGCGCTTCGGACGCGGAGACTGAAGGTTCGAA |
| Downstream region at tRNA end position |
taaaacaact |
| Secondary structure (Cloverleaf model) | >SRA1026831 Arg TCG
c ACgt taaaacaact
G - C
C - G
C - G
C - G
C - G
C - G
G - C T A
T C T T C C A
C A A G | | | | | G
T C T C G G A A G G C
G | | | + T T
G G A G T
A T A G AGACT
C - G
C - G
G - C
C - G
G - C
C A
T G
T C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |