The detailed information of tRNA gene sequence


Sequence ID>C151104964
Genome IDLN847356
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8103
Start position on genome 1954633
End posion on genome 1954723
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
tggagcctcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtt
Downstream region at tRNA end position
caaggtattc
Secondary structure (Cloverleaf model)
>C151104964	Ser	GCT
                   T      GTtt caaggtattc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK