| Sequence ID | >SRA1029403 |
| Genome ID | SRR035087.122127 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 106 |
| End posion on genome | 34 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
attattatat |
| tRNA gene sequence |
GACCCTATCGTCTAGTGGTTAGGACACTAGGTTTTCATCCTAGAAACCGGGGTTCGACTC |
| Downstream region at tRNA end position |
atgcaaaact |
| Secondary structure (Cloverleaf model) | >SRA1029403 Glu TTC
t ACtt atgcaaaact
G - C
A - T
C - G
C - G
C - G
T - A
A - T T C
T G C C C C A
T G A C | | | | | G
G T C T G C G G G G C
G + | | | T T
T G G A C
T A A AAAC
C - G
T - A
A - T
G - C
G - C
T T
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |