| Sequence ID | >SRA1030700 |
| Genome ID | SRR035087.316194 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 160 |
| End posion on genome | 241 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
aataatatat |
| tRNA gene sequence |
GGCGGTGTGATGAAATGGAAGACATGGAAGACTCAAAATCTTCTGGGAAACCGTGTAGGT |
| Downstream region at tRNA end position |
atttgaaggg |
| Secondary structure (Cloverleaf model) | >SRA1030700 Leu CAA
t ACCA atttgaaggg
G - C
G - C
C - G
G - C
G - C
T - A
G - C T C
T T A T C C A
T A A G + | | | | G
G A G T A G T A G G C
G | | | T T
A A C A T
A G G TGGGAAACCGT
G - C
A - T
A - T
G - C
A - T
C A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |