| Sequence ID | >SRA1031012 |
| Genome ID | SRR035087.360273 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 157 |
| End posion on genome | 82 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
ctttgcaaat |
| tRNA gene sequence |
GCCCATGTAGCTCAGCTGGGAGAGCAATCCCTTCGTAAGGGATAGGTCGTCGGTTCGAAT |
| Downstream region at tRNA end position |
ttaatgattt |
| Secondary structure (Cloverleaf model) | >SRA1031012 Thr CGT
t TCCA ttaatgattt
G - C
C - G
C - G
C - G
A - T
T + G
G - C T A
T C A G C C A
C G A A | | | | | G
T C T C G G T C G G C
G | | | | T T
G G A G C
G A A AGGTC
A - T
T - A
C - G
C - G
C - G
T A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |