| Sequence ID | >SRA1031533 |
| Genome ID | SRR035087.445479 |
| Phylum/Class | 454 Sequencing (SRP001808) |
| Species | |
| Start position on genome | 221 |
| End posion on genome | 146 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
ccataaatac |
| tRNA gene sequence |
GGGAGCATAGCTCAGCTGGGAGAGCACTTGCCTTACAAGCAAGGGGTCACAGGTTCGATC |
| Downstream region at tRNA end position |
cacacgcagc |
| Secondary structure (Cloverleaf model) | >SRA1031533 Val TAC
c ACCA cacacgcagc
G - C
G - C
G - C
A - T
G + T
C - G
A - T C T
T T G T C C A
C G A A | | | | | G
T C T C G A C A G G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
T - A
T - A
G - C
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |