The detailed information of tRNA gene sequence


Sequence ID>SRA1031826
Genome IDSRR035087.495309
Search identical group
Phylum/Class454 Sequencing (SRP001808)
Species
Start position on genome 152
End posion on genome 228
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
ggtaaaggag
tRNA gene sequence
GCGCTCGTAGCTCAATTGGATAGAGCTGCGGACTTCGGATCCGATGATTGGGGGTTCGAG
TCCCTCCGAGCGCGTCA
Downstream region at tRNA end position
aatttgattt
Secondary structure (Cloverleaf model)
>SRA1031826	Arg	TCG
                   g      GTCA aatttgattt
                     G - C
                     C - G
                     G - C
                     C - G
                     T - A
                     C - G
                     G - C          T G
                    T     C T C C C     A
      T A A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A T A        T     TGATT
                    G   A
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[SRA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK