| Sequence ID | >SRA1036293 |
| Genome ID | SRR035089.489104 |
| Phylum/Class | 454 Sequencing (SRP001810) |
| Species | |
| Start position on genome | 94 |
| End posion on genome | 19 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
tgtcgcacgt |
| tRNA gene sequence |
GGGTGATTAACTCAGAGGCTAGAGTGCTTCCCTTACAAGGAAGAAGTCGTAGGTTCGAAT |
| Downstream region at tRNA end position |
tttttttatc |
| Secondary structure (Cloverleaf model) | >SRA1036293 Val TAC
t ACCA tttttttatc
G - C
G - C
G - C
T + G
G - C
A - T
T - A T A
T C A T C C A
A G A A | | | | | G
G C T C A G T A G G C
G | | | | T T
C G A G T
T A G AAGTC
C - G
T - A
T - A
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |