The detailed information of tRNA gene sequence


Sequence ID>SRA1036585
Genome IDSRR035089.554987
Search identical group
Phylum/Class454 Sequencing (SRP001810)
Species
Start position on genome 209
End posion on genome 281
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
taattcttaa
tRNA gene sequence
AGCCCCTTAGTACAGCGGTCAAGTATACAGCCCTTTGAAGGCTGTGACCCAGGTTCGAAT
CCTGGAGGGGCTAtta
Downstream region at tRNA end position
tggtgtttta
Secondary structure (Cloverleaf model)
>SRA1036585	Gln	TTG
                   a      Atta tggtgtttta
                     A - T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     T - A          T A
                    T     G G T C C     A
      C G A        A      | | | | |     G
    G       C A T G       C C A G G     C
    G       | | | +                 T T
    T       G T A T
      C A A        A     TGAC
                    C - G
                    A - T
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[SRA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK