The detailed information of tRNA gene sequence


Sequence ID>SRA1036724
Genome IDSRR035089.595065
Search identical group
Phylum/Class454 Sequencing (SRP001810)
Species
Start position on genome 230
End posion on genome 142
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
atgcatattt
tRNA gene sequence
GCCGGAGTGGCGAAATTGGTAGACGCACTGGACTCAAAATCCAGCGAGCCTCACGGCTCG
TGTCGGTTCGACTCCGACCTTCGGCACCA
Downstream region at tRNA end position
tcattccgta
Secondary structure (Cloverleaf model)
>SRA1036724	Leu	CAA
                   t      ACCA tcattccgta
                     G - C
                     C - G
                     C - G
                     G - C
                     G + T
                     A - T
                     G - C          T C
                    T     C A G C C     A
      T A A        G      | | | | |     G
    T       A G C G       G T C G G     C
    G         | | |                 T T
    G       A C G C
      T A G        A     CGAGCCTCACGGCTCGT
                    C - G
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.[SRA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK