| Sequence ID | >SRA1038989 |
| Genome ID | SRR035090.404327 |
| Phylum/Class | 454 Sequencing (SRP001811) |
| Species | |
| Start position on genome | 169 |
| End posion on genome | 244 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
actctttaat |
| tRNA gene sequence |
GGAGCTGTAGCTCAGTCTGGTTAGAGCGCCTGCCTGTCACGCAGGAGGTCGCGGGTTCGA |
| Downstream region at tRNA end position |
aaaaaaggtc |
| Secondary structure (Cloverleaf model) | >SRA1038989 Asp GTC
t GCag aaaaaaggtc
G - C
G - C
A - T
G - C
C - G
T - A
G - C C G
T T G C C C A
C T G A A + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
C - G
T - A
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |