The detailed information of tRNA gene sequence


Sequence ID>SRA1042542
Genome IDSRR035091.405596
Search identical group
Phylum/Class454 Sequencing (SRP001812)
Species
Start position on genome 292
End posion on genome 362
Amino Acid Tyr
Anticodon GTA
Upstream region at tRNA start position
ttatttttac
tRNA gene sequence
CCCCTCATAGCTTAGTGGCAGAGCGGTTGGCTGTAGCCCGACATGTCCCAGTTCGATTCT
GGGTGGGGGGAttt
Downstream region at tRNA end position
ggatttagta
Secondary structure (Cloverleaf model)
>SRA1042542	Tyr	GTA
                   c      Attt ggatttagta
                     C - G
                     C - G
                     C - G
                     C - G
                     T + G
                     C - G
                     A - T          T T
                    T     G G G T C     A
        G A        A      | | | | |     G
      T     T T C G       C C C A G     C
      G     + | | |                 T T
      G     G A G C
        C A        G     ATGT
                    G - C
                    T - A
                    T + G
                    G - C
                    G - C
                  C       C
                  T       G
                    G T A
Intron
Comment/Decision
Genome/Seq. Info.[SRA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK