| Sequence ID | >SRA1043928 |
| Genome ID | SRR035092.196137 |
| Phylum/Class | 454 Sequencing (SRP001813) |
| Species | |
| Start position on genome | 194 |
| End posion on genome | 267 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
attaaaataa |
| tRNA gene sequence |
GGTCCCATCGTATAACGGCTTAATATGACAGGCTTTCATCCTGTCGATGGAGGGTTCGAT |
| Downstream region at tRNA end position |
tttattgcgg |
| Secondary structure (Cloverleaf model) | >SRA1043928 Glu TTC
a Attt tttattgcgg
G - C
G + T
T - A
C - G
C - G
C - G
A - T T T
T C C C C C A
C A A C | | | | G
G T A T G G A G G G C
G | | | + T T
C A T A T
T T A G CGATG
A - T
C - G
A - T
G - C
G - C
C T
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |