| Sequence ID | >SRA1047667 |
| Genome ID | SRR035094.16903 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 225 |
| End posion on genome | 299 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
cttctataga |
| tRNA gene sequence |
GCGGGCGTAATTCAGGGGTAGAATGTCAGCTTCCCAAGCTGAATGTCGTGGGTTCGAATC |
| Downstream region at tRNA end position |
atctttttgg |
| Secondary structure (Cloverleaf model) | >SRA1047667 Gly CCC
a TCCA atctttttgg
G - C
C - G
G - C
G - C
G - C
C - G
G - C T A
T T A C C C A
G A A + | | | | G
G C T T A G T G G G C
G | | | | T T
G G A A T
T A G ATGTC
T - A
C - G
A - T
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |