| Sequence ID | >SRA1047909 |
| Genome ID | SRR035094.65390 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 297 |
| End posion on genome | 223 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
cccctttttT |
| tRNA gene sequence |
TGGAGTAAAGCTCAGCAGGCAGAGCATTCGCTTGATAAGCGAAAGGCCGAAGGTTCGAAT |
| Downstream region at tRNA end position |
aacgggttga |
| Secondary structure (Cloverleaf model) | >SRA1047909 Ile GAT
T ATta aacgggttga
T - A
G - C
G - C
A - T
G - C
T + G
A - T T A
A C T T C C A
C G A A | | | | | G
A C T C G G A A G G C
G | | | | T T
G G A G C
C A A AGGCC
T - A
T - A
C - G
G - C
C - G
T A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |