| Sequence ID | >SRA1054169 |
| Genome ID | SRR035099.74633 |
| Phylum/Class | 454 Sequencing (SRP001820) |
| Species | |
| Start position on genome | 433 |
| End posion on genome | 358 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
tctcttgaat |
| tRNA gene sequence |
GGACAGATAGCTCAGTTGGTAGAGCAATGGACTGAAAATCCATGTGTCGTGGGTTCGATT |
| Downstream region at tRNA end position |
tggtataccg |
| Secondary structure (Cloverleaf model) | >SRA1054169 Phe GAA
t ACCA tggtataccg
G - C
G - C
A - T
C - G
A - T
G - C
A - T T T
T C T C C C A
T G A A | | | | G
T C T C G G T G G G C
G | | | | T T
G G A G C
T A A GTGTC
A - T
T - A
G - C
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |