Sequence ID | >SRA1015434 |
Genome ID | SRR023846.55842 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 173 |
End posion on genome | 244 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tataatcaga |
tRNA gene sequence |
CAGACTGATGGCCTAACGGAAGGGCGCTCACTTTGGGAGTGAGAGCTGGAAGTTCGACTC |
Downstream region at tRNA end position |
tgttatttat |
Secondary structure (Cloverleaf model) | >SRA1015434 Pro TGG a Ataa tgttatttat C - G A - T G - C A A C - G T - A G - C T C A C C T T C A A A T T | | | | | G C C C G G G G A A G C G | | | T T G G G G C A A G AGCT C - G T - A C - G A - T C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |