Sequence ID | >SRA1015501 |
Genome ID | SRR023846.86649 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 60 |
End posion on genome | 131 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
taattataaa |
tRNA gene sequence |
TATGTAGTAGACTAATGGTAAGTCATAAATTTTTGGTATTTACTTATGGGTGTTCGAATC |
Downstream region at tRNA end position |
ggtggatata |
Secondary structure (Cloverleaf model) | >SRA1015501 Gln TTG a Gtaa ggtggatata T - A A - T T - A G - C T - A A - T G - C T A T C C C A C A A A A | | | | | G T T C A G G G G T G C G | | | | T T G A G T C T A A CTTAT T - A A - T A - T A - T T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |