Sequence ID | >SRA1016308 |
Genome ID | SRR023846.444064 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 54 |
End posion on genome | 127 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gcaatctgaT |
tRNA gene sequence |
GTCGTTGTAGTATAGTGGTTAGTATGAACCCTTGTGGCGGGTTTGACACGCGTTCGATTC |
Downstream region at tRNA end position |
tttttgaatt |
Secondary structure (Cloverleaf model) | >SRA1016308 His GTG T AAaa tttttgaatt G - C T - A C - G G - C T - A T + G G - C T T T T G C G C A T G A A | | | | | G G T A T G A C G C G C G + | | + T T T G T A T T A G TGAC A - T A - T C - G C - G C - G T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |