Sequence ID | >SRA1016341 |
Genome ID | SRR023846.458989 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 39 |
End posion on genome | 112 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tataatgtaa |
tRNA gene sequence |
CGAGATATAGTGTAATTTGGTAACATATTCTGTTTTGGGTACAGCTGATTTCAGTTCAAA |
Downstream region at tRNA end position |
caatttatta |
Secondary structure (Cloverleaf model) | >SRA1016341 Pro TGG a Aatt caatttatta C - G G - C A - T G - C A - T T - A A - T T A T A A G T C A T A A A | | | | | A T T G T G T T C A G C T | | | + T T G A C A T G T A A CTGAT T + G T - A C C T - A G + T T G T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |