Sequence ID | >SRA1016358 |
Genome ID | SRR023846.464220 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 34 |
End posion on genome | 106 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
attgttgagg |
tRNA gene sequence |
TATCTTGTGGACTAATGGGTAAGTCATAAATTTTTGATATTTACTATTGAGTGTTCGAAT |
Downstream region at tRNA end position |
aagagggtcg |
Secondary structure (Cloverleaf model) | >SRA1016358 Gln TTG g Attt aagagggtcg T - A A - T T - A C - G T - A T - A G - C T A T C T C A C A T A A G | | | | | G G T C A G G A G T G C G | | | | T T G A G T C T A A CTATT T - A A - T A - T A - T T - A T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |