Sequence ID | >SRA1016555 |
Genome ID | SRR023846.563468 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 70 |
End posion on genome | 152 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
catttatctg |
tRNA gene sequence |
GATGTTGTGGCCGAGCGGTCTAAGGCGGCGCGTTAAGGTCGCGTTCCATTTCATGGGCGT |
Downstream region at tRNA end position |
tcctttttcc |
Secondary structure (Cloverleaf model) | >SRA1016555 Leu AAG g Aaat tcctttttcc G - C A - T T - A G - C T - A T - A G - C T A T C A C T C A C G A G | | | | | G G G C C G G T G A G C G | | | T T T A G G C C T A G TCCATTTCATGGGC G + T C - G G - C C - G G - C T T T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |