| Sequence ID | >ENV09000046 |
| Genome ID | ABSN01002176 |
| Phylum/Class | Freshwater sediment metagenome lwFormaldehyde_C1 |
| Species | |
| Start position on genome | 703 |
| End posion on genome | 630 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
cgcttccccg |
| tRNA gene sequence |
GGCGGGGTGGCAGAGTGGTCATGCAGCGGCCTGCAAAGCCGTGTACGCCGGTTCGATTCC |
| Downstream region at tRNA end position |
aacgctcccc |
| Secondary structure (Cloverleaf model) | >ENV09000046 Cys GCA
g TCCA aacgctcccc
G - C
G - C
C - G
G - C
G - C
G - C
G - C T T
T C A G C C A
G A G | | | | G
T G A C G G C C G G C
G | | | T T
G A T G C
T C A GTAC
G + T
C - G
G - C
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |