| Sequence ID | >ENV09000439 |
| Genome ID | ABSN01069331 |
| Phylum/Class | Freshwater sediment metagenome lwFormaldehyde_C1 |
| Species | |
| Start position on genome | 208 |
| End posion on genome | 132 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
gttaaattat |
| tRNA gene sequence |
TGGGGAGTCGCCAAGTTGGTTAAGGCACTGGGTTTTGATCCCAGCATCCGAAGGTTCGAG |
| Downstream region at tRNA end position |
gaatttagaa |
| Secondary structure (Cloverleaf model) | >ENV09000439 Gln TTG
t GCCA gaatttagaa
T - A
G - C
G + T
G - C
G - C
A - T
G - C T G
T C T T C C A
T G A C | | | | | G
T A C C G G A A G G C
G | | | T T
G A G G C
T T A A CATCC
C - G
T - A
G - C
G - C
G - C
T T
T A
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |