| Sequence ID | >ENV09001322 |
| Genome ID | ABSR01001345 |
| Phylum/Class | Freshwater sediment metagenome lwMethylamine_C1 |
| Species | |
| Start position on genome | 1380 |
| End posion on genome | 1304 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
tgccggcctt |
| tRNA gene sequence |
CGGCGTGTAGCGTAGCCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCGAA |
| Downstream region at tRNA end position |
tatatccccc |
| Secondary structure (Cloverleaf model) | >ENV09001322 Pro TGG
t ACCA tatatccccc
C - G
G - C
G - C
C - G
G - C
T - A
G - C T A
T C T C T C A
C G A A | + | | | G
C T G C G G G G A G C
T + | | | T T
G G C G C
G T A G ATGTC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |