| Sequence ID | >ENV09001571 |
| Genome ID | ABSR01031140 |
| Phylum/Class | Freshwater sediment metagenome lwMethylamine_C1 |
| Species | |
| Start position on genome | 86 |
| End posion on genome | 10 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
cttatcgcat |
| tRNA gene sequence |
CGGGGCGTGGCTCAGCCTGGTAGAGCGCTCGGTTCGGGACCGAGATGTCGGAGGTTCAAA |
| Downstream region at tRNA end position |
caagatcttn |
| Secondary structure (Cloverleaf model) | >ENV09001571 Pro CGG
t ACCA caagatcttn
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T T C T C C A
C G A G + | | | | A
C C T C G G G A G G C
T | | | | T T
G G A G C
G T A G ATGTC
C - G
T - A
C - G
G - C
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |