The detailed information of tRNA gene sequence


Sequence ID>ENV09001595
Genome IDABSR01034670
Search identical group
Phylum/ClassFreshwater sediment metagenome lwMethylamine_C1
Species
Start position on genome 364
End posion on genome 437
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
tcacatataa
tRNA gene sequence
GGCGCGATAGCAAAGCGGTTATGCCGCGGCCTGCAAAGCCGTTTAGACCAGTTCGACTCT
GGTTCGCGCCTCCA
Downstream region at tRNA end position
aaaatctctc
Secondary structure (Cloverleaf model)
>ENV09001595	Cys	GCA
                   a      TCCA aaaatctctc
                     G - C
                     G - C
                     C - G
                     G - C
                     C - G
                     G - C
                     A - T          T C
                    T     T G G T C     A
        G A        A      | | | | |     G
      C     A A C G       A C C A G     C
      G       | | |                 T T
      G     A T G C
        T T        C     TTAG
                    G + T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK