The detailed information of tRNA gene sequence


Sequence ID>W1510020484
Genome IDBBXZ01000116
Search identical group
Phylum/ClassChloroflexi
SpeciesLevilinea saccharolytica KIBI-1 [BBXZ]
Start position on genome 44618
End posion on genome 44543
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
tcattcgttc
tRNA gene sequence
GGGGGCGTGGTGTAGTGGCTAACATGCGGCCCTGTCAAGGCCGAGACCGCGGGTTCGAAC
CCCGTCGCTCCCGCCA
Downstream region at tRNA end position
ctcaatcaag
Secondary structure (Cloverleaf model)
>W1510020484	Asp	GTC
                   c      GCCA ctcaatcaag
                     G - C
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     G - C          C A
                    T     T G C C C     A
      T G A        G      + | | | |     G
    G       T G T G       G C G G G     C
    G       | | | +                 T T
    C       A C A T
      T A          G     AGACC
                    C - G
                    G - C
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK