The detailed information of tRNA gene sequence


Sequence ID>W1510076774
Genome IDCDPL01000020
Search identical group
Phylum/ClassAtribacteria
SpeciesAtribacteria bacterium JGI 0000014-F07 [CDPL]
Start position on genome 5546
End posion on genome 5633
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
aatagatgat
tRNA gene sequence
GGAGGGGTGGCAGAGCGGCTGAATGCACCGGTCTTGAAAACCGGCGATACGAGAGTATCC
GTGGGTTCAAATCCCACCCCCTCCGCCA
Downstream region at tRNA end position
cttatttctg
Secondary structure (Cloverleaf model)
>W1510076774	Ser	TGA
                   t      GCCA cttatttctg
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C A C C C     A
      C G A        G      | | | | |     A
    G       G A C G       G T G G G     C
    G         | | |                 T T
    C       A T G C
      T G A        A     CGATACGAGAGTATCC
                    C - G
                    C - G
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK