The detailed information of tRNA gene sequence


Sequence ID>W1510076779
Genome IDCDPL01000047
Search identical group
Phylum/ClassAtribacteria
SpeciesAtribacteria bacterium JGI 0000014-F07 [CDPL]
Start position on genome 5784
End posion on genome 5858
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
acttattttt
tRNA gene sequence
GCGGAAATAGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGGGTTCGAATC
CCGTTTTCCGCTCCA
Downstream region at tRNA end position
cgtctgtcaa
Secondary structure (Cloverleaf model)
>W1510076779	Gly	GCC
                   t      TCCA cgtctgtcaa
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     A - T
                     A - T          T A
                    T     T G C C C     A
        G A        A      + | | | |     G
      T     C T C G       G C G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     GGGTC
                    T - A
                    C - G
                    G - C
                    C - G
                    C - G
                  T       A
                  T       A
                    G C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK