The detailed information of tRNA gene sequence


Sequence ID>W10120580
Genome IDADXM01000029
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. CB0205 [ADXM]
Start position on genome 21423
End posion on genome 21513
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
gcgggccacT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtc
Downstream region at tRNA end position
ccgaccggga
Secondary structure (Cloverleaf model)
>W10120580	Ser	GCT
                   T      GTtc ccgaccggga
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK