The detailed information of tRNA gene sequence


Sequence ID>W10123457
Genome IDADZZ01000613
Search identical group
Phylum/ClassDeltaproteobacteria
Speciesdelta proteobacterium NaphS2 [ADZZ]
Start position on genome 97071
End posion on genome 96996
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ggaatattgt
tRNA gene sequence
GCGGGCATAGCTCAGTTGGTAGAGTACAAGCTTCCCAAGCTTGGTGTCGCGGGTTCGAAC
CCCGTTGCCCGCTCCA
Downstream region at tRNA end position
tatgaggccg
Secondary structure (Cloverleaf model)
>W10123457	Gly	CCC
                   t      TCCA tatgaggccg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     A - T          C A
                    T     T G C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G C G G G     C
    G       | | | +                 T T
    G       G A G T
      T A          A     GTGTC
                    C - G
                    A - T
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK