The detailed information of tRNA gene sequence


Sequence ID>C10105545
Genome IDFN666575
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesErwinia amylovora ATCC 49946
Start position on genome 2559955
End posion on genome 2560026
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcagttcaac
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACAata
Downstream region at tRNA end position
cttcacagtt
Secondary structure (Cloverleaf model)
>C10105545	Arg	CCT
                   c      Aata cttcacagtt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK