| Sequence ID | >C11118138 |
| Genome ID | CP002446 |
| Phylum/Class | Gammaproteobacteria |
| Species | Pseudoxanthomonas suwonensis 11-1 [CP002446] |
| Start position on genome | 1366882 |
| End posion on genome | 1366958 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
cccccggctt |
| tRNA gene sequence |
GGCCCCGTAGCTCAGCTGGATAGAGCGTCCCCCTCCTAAGGGGAAGGTCGCACGTTCGAA |
| Downstream region at tRNA end position |
ggctttcccg |
| Secondary structure (Cloverleaf model) | >C11118138 Arg CCT
t GCCA ggctttcccg
G - C
G - C
C - G
C - G
C - G
C - G
G - C T A
T T G T G C A
C G A A + | | | | G
T C T C G G C A C G C
G | | | | T T
G G A G C
A T A G AGGTC
T - A
C - G
C - G
C - G
C - G
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |