The detailed information of tRNA gene sequence


Sequence ID>C11118138
Genome IDCP002446
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPseudoxanthomonas suwonensis 11-1
Start position on genome 1366882
End posion on genome 1366958
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
cccccggctt
tRNA gene sequence
GGCCCCGTAGCTCAGCTGGATAGAGCGTCCCCCTCCTAAGGGGAAGGTCGCACGTTCGAA
TCGTGTCGGGGCCGCCA
Downstream region at tRNA end position
ggctttcccg
Secondary structure (Cloverleaf model)
>C11118138	Arg	CCT
                   t      GCCA ggctttcccg
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T G T G C     A
      C G A        A      + | | | |     G
    T       C T C G       G C A C G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGTC
                    T - A
                    C - G
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK