The detailed information of tRNA gene sequence


Sequence ID>C11120816
Genome IDCP002783
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSinorhizobium meliloti AK83
Start position on genome 210058
End posion on genome 209963
Amino Acid SeC
Anticodon TCA
Upstream region at tRNA start position
ttcgtcgcct
tRNA gene sequence
GGAAGAGAATCATGCCCGGTGGCATGTCCGGACTTCAAATCCGGGTGGGGCAGCGAGGCT
GTCTTGGGTGGGTTCGACTCCCATTCTCTTCCGCCA
Downstream region at tRNA end position
tcaggagacc
Secondary structure (Cloverleaf model)
>C11120816	SeC	TCA
                   t      GCCA tcaggagacc
                     G - C
                     G - C
                     A - T
                     A - T
                     G - C
                     A - T
                     G - C
                     A - T          T C
                    A     T A C C C     A
      C C C        T      + | | | |     G
    G       G T A C       G T G G G     C
    G       | | | |                 T T
    T       C A T G
      G G          T     GTGGGGCAGCGAGGCTGTCTTGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK