The detailed information of tRNA gene sequence


Sequence ID>W1511499283
Genome IDJXAC01000319
Search identical group
Phylum/ClassBacteroidetes
SpeciesSphingobacterium sp. T2 [JXAC]
Start position on genome 600
End posion on genome 676
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
agatgcagct
tRNA gene sequence
AGTCCCGTAGCTCAGTTGGTTAGAGCACTACACTGATAATGTAGGGGTCAGCAGTTCAAG
TCTGCTCGGGACTACCA
Downstream region at tRNA end position
agattaacgc
Secondary structure (Cloverleaf model)
>W1511499283	Ile	GAT
                   t      ACCA agattaacgc
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     T C G T C     A
      T G A        A      | | | | |     A
    T       C T C G       A G C A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK