The detailed information of tRNA gene sequence


Sequence ID>W1511526796
Genome IDJYGY01000002
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus sp. 361 [JYGY]
Start position on genome 111776
End posion on genome 111680
Amino Acid SeC
Anticodon TCA
Upstream region at tRNA start position
gaaggaccgC
tRNA gene sequence
GGAAGGGCATCAGACCCGGTGGTTTGGCCGGACTTCAAATCCGGTTGGGGCAGCGAGCCT
GTCCCGGGTGGGTTCGACTCCCATTCCCTTCCGCC
Downstream region at tRNA end position
Agccttcccc
Secondary structure (Cloverleaf model)
>W1511526796	SeC	TCA
                   C      CGCC Agccttcccc
                     G - C
                     G + T
                     A - T
                     A   C
                     G - C
                     G - C
                     G + T          T C
                    C     T A C C C     A
      C C A        A      + | | | |     G
    C       G A C T       G T G G G     C
    G       + |   +                 T T
    G       T T T G
      T G G        G     TTGGGGCAGCGAGCCTGTCCCGG
                    C - G
                    C - G
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T C A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK