Sequence ID | >W1511575080 |
Genome ID | LAOP01000001 |
Phylum/Class | Alphaproteobacteria |
Species | Rickettsia endosymbiont of Ixodes pacificus of Ixodes pacificus Humboldt [LAOP] |
Start position on genome | 593822 |
End posion on genome | 593898 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tctatattgt |
tRNA gene sequence |
GGGTTTGTAGCTCAGCTGGTTAGAGCACACGCCTGATAAGCGTGAGGTCGGAAGTTCAAG |
Downstream region at tRNA end position |
ctaaatccac |
Secondary structure (Cloverleaf model) | >W1511575080 Ile GAT t ACCA ctaaatccac G - C G - C G - C T - A T - A T - A G - C T G T T C T T C A C G A A + | | | | A T C T C G G G A A G C G | | | | T T G G A G C T T A A AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |