Sequence ID | >W1511575092 |
Genome ID | LAOP01000001 |
Phylum/Class | Alphaproteobacteria |
Species | Rickettsia endosymbiont of Ixodes pacificus of Ixodes pacificus Humboldt [LAOP] |
Start position on genome | 1426816 |
End posion on genome | 1426741 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaaatatgat |
tRNA gene sequence |
AGGAGTGTAGCTCAATTGGTAGAGCACCGGTCTCCAAAACCGGAGGTTGCGGGTTCGATG |
Downstream region at tRNA end position |
ttatagattt |
Secondary structure (Cloverleaf model) | >W1511575092 Trp CCA t GCCA ttatagattt A - T G - C G - C A - T G - C T + G G - C G T T T G T C C A T A A A + | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |