Sequence ID | >W1511575098 |
Genome ID | LAOP01000001 |
Phylum/Class | Alphaproteobacteria |
Species | Rickettsia endosymbiont of Ixodes pacificus of Ixodes pacificus Humboldt [LAOP] |
Start position on genome | 1018523 |
End posion on genome | 1018449 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttttatttaa |
tRNA gene sequence |
GCGGGTGTAGCTCAGGGGTAGAGCGCTACCTTGCCAAGGTCGAAGTCGAGGGTTCGAATC |
Downstream region at tRNA end position |
gtgatttttt |
Secondary structure (Cloverleaf model) | >W1511575098 Gly GCC a TCCA gtgatttttt G - C C - G G - C G - C G - C T - A G - C T A T T T C C C A G A A + | | | | G G C T C G G A G G G C G | | | | T T G G A G C T A G AAGTC C - G T C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |