Sequence ID | >W1511575108 |
Genome ID | LAOP01000001 |
Phylum/Class | Alphaproteobacteria |
Species | Rickettsia endosymbiont of Ixodes pacificus of Ixodes pacificus Humboldt [LAOP] |
Start position on genome | 71612 |
End posion on genome | 71537 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
taaaaaatat |
tRNA gene sequence |
GGGCGATTAGCTCAGCTGGTAGAGTATCTCGTTTACACCGAGAGTGTCGGCGGTTCGAGT |
Downstream region at tRNA end position |
atcaaaagtt |
Secondary structure (Cloverleaf model) | >W1511575108 Val TAC t ACCA atcaaaagtt G - C G - C G - C C - G G - C A - T T - A T G T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | + T T G G A G T T A A GTGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |