The detailed information of tRNA gene sequence


Sequence ID>W1511602613
Genome IDLBWK01000002
Search identical group
Phylum/Classunclassified Bacteria
Speciescandidate division WS6 bacterium GW2011_GWF2_39_15 [LBWK]
Start position on genome 333577
End posion on genome 333653
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gattctatta
tRNA gene sequence
GGGCGATTAGCTCAGCTGGTTAGAGCATCTCGTTTACACCGAGAGGGTCGGGGGTTCGAA
TCCCTCATCGCCCACCA
Downstream region at tRNA end position
tttatccctt
Secondary structure (Cloverleaf model)
>W1511602613	Val	TAC
                   a      ACCA tttatccctt
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C
                     A - T
                     T - A          T A
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GGGTC
                    T - A
                    C - G
                    T - A
                    C - G
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK