The detailed information of tRNA gene sequence


Sequence ID>C121018333
Genome IDHE617160
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea ananatis LMG 5342
Start position on genome 1396633
End posion on genome 1396559
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ctgcgctggc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tgtatgcctt
Secondary structure (Cloverleaf model)
>C121018333	Arg	CCT
                   c      ACCA tgtatgcctt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK