| Sequence ID | >WENV051075 |
| Genome ID | AACY022928993 |
| Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
| Species | |
| Start position on genome | 571 |
| End posion on genome | 492 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
cacttaatcT |
| tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTTATCGCGCCTCGTTTGGGACGAGGAGGTCGCAGGTTCGA |
| Downstream region at tRNA end position |
Attaactctc |
| Secondary structure (Cloverleaf model) | >WENV051075 Pro TGG
T ACAG Attaactctc
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T C G T C C A
C C G A A | | | | | G
C T G C G G C A G G C
G | | | T T
G T C G C
T T A G AGGTC
C - G
C - G
T - A
C - G
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |