The detailed information of tRNA gene sequence


Sequence ID>C161037967
Genome IDCP011941
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8020
Start position on genome 2549015
End posion on genome 2548925
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ctttgctgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtt
Downstream region at tRNA end position
taaacaagtc
Secondary structure (Cloverleaf model)
>C161037967	Ser	GCT
                   T      GTtt taaacaagtc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK