The detailed information of tRNA gene sequence


Sequence ID>C161050444
Genome IDCP013062
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYA2_FULL_PER-ii_58_14
Start position on genome 914627
End posion on genome 914717
Amino Acid Ser
Anticodon CGA
Upstream region at tRNA start position
cgggatgcgt
tRNA gene sequence
GGAGGGATGGCCGAGTGGTTGAAGGCGCACGACTCGAAATCGTGTAGGCCCCCAAAGGGT
CTCGAGGGTTCGAATCCCTCTCCCTCCGCCA
Downstream region at tRNA end position
gtctgcaccc
Secondary structure (Cloverleaf model)
>C161050444	Ser	CGA
                   t      GCCA gtctgcaccc
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G C C G       G A G G G     C
    G         | | |                 T T
    T       A G G C
      T G A        G     TAGGCCCCCAAAGGGTCTC
                    C - G
                    A - T
                    C - G
                    G - C
                    A - T
                  C       A
                  T       A
                    C G A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK