The detailed information of tRNA gene sequence


Sequence ID>C161050449
Genome IDCP013062
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYA2_FULL_PER-ii_58_14
Start position on genome 1120778
End posion on genome 1120852
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gatccacctc
tRNA gene sequence
GCTCCTGTAGTTCAACGGATAGAACAATCGCGTCCTAAGCGATGGATGCAGGTTCAATTC
CTGCCGGGAGCACCA
Downstream region at tRNA end position
cagaaatata
Secondary structure (Cloverleaf model)
>C161050449	Arg	CCT
                   c      ACCA cagaaatata
                     G - C
                     C - G
                     T - A
                     C - G
                     C - G
                     T + G
                     G - C          T T
                    T     C G T C C     A
      C A A        A      | | | | |     A
    G       C T T G       G C A G G     C
    G       | | | |                 T T
    A       G A A C
      T A          A     GGAT
                    A - T
                    T - A
                    C - G
                    G - C
                    C - G
                  G       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK