The detailed information of tRNA gene sequence


Sequence ID>C161050458
Genome IDCP013062
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYA2_FULL_PER-ii_58_14
Start position on genome 621459
End posion on genome 621383
Amino Acid Val
Anticodon GAC
Upstream region at tRNA start position
ggctttaaac
tRNA gene sequence
GGGCAGTTAGCTCAGTTGGTTAGAGCGTCGCGTTGACATCGCGGAGGTCACTGGTTCGAA
TCCAGTACTGCCCACCA
Downstream region at tRNA end position
ttcggtttct
Secondary structure (Cloverleaf model)
>C161050458	Val	GAC
                   c      ACCA ttcggtttct
                     G - C
                     G - C
                     G - C
                     C - G
                     A - T
                     G - C
                     T - A          T A
                    T     T G A C C     A
      T G A        A      | | | | |     G
    T       C T C G       A C T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    T + G
                    C - G
                    G - C
                    C - G
                    G - C
                  T       T
                  T       A
                    G A C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK